run_sliding_window.pl - Clusters reads using a sliding window approach
# Minimal argument call specifying all required parameters.
run_sliding_window.pl --input Mapping_day0_1_i_Eland_against_mature_unambiguous.txt
--output sliding_cluster_file.txt
# Maximum argument call specifying all possible parameters; Several different input files may be specified
# Note that also the file containing the ambiguous hits may be specified
run_sliding_window.pl --output sliding_cluster_file.txt --min_length 15 --max_length 32 --max_mm 2 --strand RF
--min_count 10 --max_ambiguity 2 --tempdir "/tmp"
--input Mapping_day0_1_i_Eland_against_mature_unambiguous.txt
--input Mapping_day0_1_i_Eland_against_mature_ambiguous.txt
The input files; Several files may be specified, e.g.: --input file1 --input file2.
The input files have to be output files of the script run_Mapping or run_Multimapper.
Note that unambiguously and ambiguously mapped reads may be provided for this script. Mandatory parameter.
The output file. Mandatory parameter
Only reads mapping to the specified strand will be used. Reads from different strands will however never be clustered into the same sliding window. Possible values: R (reverse strand), F (forward strand), RF (both strands); default=RF
The minimum length of reads. Shorter reads will be ignored. default=15
The maximum length of reads. Longer reads will be ignored. default=100
The maximum number of mismatches. Reads having more mismatches will not be used. default=2
The maximum ambiguity of the hits. Hits having a higher ambiguity will be ignored. The ambiguity is an integer value which relates how often a read could be mapped with an equal good score (number of mismatches) to the reference sequence. Examples:
A read which could be mapped to the H. sapiens genome only once having two mismatches, will have a ambiguity of "1".
A read which could be mapped to the H. sapiens genome three times, always having one mismatch, will have a ambiguity of "3".
A read which could be mapped to the H. sapiens genome three times having one mismatch and one time having zero mismatches, will have a ambiguity of "1".
A read which could be mapped to the H. sapiens genome three times having one mismatch and two times having zero mismatches, will have a ambiguity of "2".
default=5
Minimum counts for a sliding window cluster. Clusters having less reads will not be reported. default=1
The size of the sliding window; default=1000
The size of the sliding window steps. Must be smaller or equal than --window_size. If the step_size is smaller than the window_size the sliding windows will be overlapping. default=--window_size
The path to the temporary directory. default=/tmp
Display the help pages.
The script clusters hits using a sliding window approach. The sliding windows may be overlapping or abutting. Details for each sliding window cluster are finally provided in the output file.
Mapping results of the script run_Mapping.pl or run_Multimapper.pl.
Note that unambiguous and ambiguous mapping results may be provided.
For example:
24688||Count=3 TACCCTGTAGATCCGAATTTGT hsa-miR-10a MIMAT0000253 Homo sapiens miR-10a 1 0 F 1 128318||Count=2 TACCCTGTAGATCCGAATTTGTG hsa-miR-10a MIMAT0000253 Homo sapiens miR-10a 1 0 F 1 150952||Count=1 TACCCTGTAGATCCTAATTTGTGT hsa-miR-10a MIMAT0000253 Homo sapiens miR-10a 1 2 R 1 212857||Count=1 TACCCTGTAGATCCAAATTTGT hsa-miR-10a MIMAT0000253 Homo sapiens miR-10a 1 1 F 1 317801||Count=1 TACCTTGTAGATCCGAATTTGTG hsa-miR-10a MIMAT0000253 Homo sapiens miR-10a 1 1 F 1 389805||Count=1 TACCCTGTATATCCGAATTTGTGG hsa-miR-10a MIMAT0000253 Homo sapiens miR-10a 1 2 F 1
Ambiguity is an important concept in the MIRO-pipeline, it is therefore crucial that this concept is properly understood. In a nutshell, ambigutiy is the number of equal good mapping positions for a single Solexa-read. Equal good in this context refers to the number of mismatches. In the MIRO-pipeline all unambiguously mapped reads have a ambiguity of "1" and they are provided in a separate output-file. All ambiguously mapped reads, on the other hand, have a ambiguity of ">=2"
Examples:
A read which could be mapped to the H. sapiens genome only once having two mismatches, will have a ambiguity of "1".
A read which could be mapped to the H. sapiens genome three times, always having only one mismatch, will have a ambiguity of "3".
A read which could be mapped to the H. sapiens genome three times having one mismatch and one time having zero mismatches, will have a ambiguity of "1".
A read which could be mapped to the H. sapiens genome three times having one mismatch and two times having zero mismatches, will have a ambiguity of "2".
A "Cluster" file which contains detailed information for each cluster. This is the same output file as used for the script cluster_overlapping_hits.pl.
Since for sliding window clustering some parameters are meaningless, like the mean_start, this parameters are left blank (indicated with "-"). The parameters are however kept for reasons of compatibility and to provide a single output format.
Following an example:
query_id count mean_length mean_ambiguity reference_id strand start end mean_start std_start mean_end std_end std_length mean_mismatches sequence slide_3 10 15.9 1.1 hsa-mir-1233 MI0006323 Homo sapiens miR-1233 stem-loop F 1 1000 - - - - 1.29 2.0 - slide_5 32 22.0 1.0 hsa-mir-1292 MI0006433 Homo sapiens miR-1292 stem-loop F 1 1000 - - - - 3.81 0.7 - slide_6 97 16.0 1.1 hsa-mir-1181 MI0006274 Homo sapiens miR-1181 stem-loop F 1 1000 - - - - 1.40 1.9 - slide_8 101 21.9 1.0 hsa-mir-548k MI0006354 Homo sapiens miR-548k stem-loop F 1 1000 - - - - 0.54 0.3 -
Another example:
query_id count mean_length mean_ambiguity reference_id strand start end mean_start std_start mean_end std_end std_length mean_mismatches sequence slide_28 11 20.0 2.0 chrX R 512001 513000 - - - - 0.45 2.0 - slide_47 11 25.2 2.0 chrX R 1465001 1466000 - - - - 4.79 0.3 - slide_49 12 29.6 2.0 chrX R 1468001 1469000 - - - - 3.40 0.7 - slide_138 10 20.9 1.8 chrX R 3641001 3642000 - - - - 3.38 0.7 -
The ID of the sliding window. IDs are assigned as successive numbers.
The total number of reads assigned to this sliding window.
The average length of the reads assigned to this sliding window
The average ambiguity of the reads assigned to this sliding window. See also Ambiguity
The reference sequence ID on which this sliding window is located
The strand on which this sliding window is located, either F or R
The start position of the sliding window.
The end position of the sliding window.
Meaningless for sliding window clustering thus left blank (indicated by "-")
Meaningless for sliding window clustering thus left blank (indicated by "-")
Meaningless for sliding window clustering thus left blank (indicated by "-")
Meaningless for sliding window clustering thus left blank (indicated by "-")
The standar deviation of the average read length
The average number of mismatches of the reads assigned to this sliding window
Meaningless for sliding window clustering thus left blank (indicated by "-")
Perl 5.8 or higher
Robert Kofler
Heinz Himmelbauer
robert.kofler at crg.es